RegulonDB RegulonDB 10.8: Gene Sequence
bdm gene sequence


Size: 216        A: 62  T: 56  G: 48  C: 50

Fasta

 

>bdm E. coli K12. Version NC_000913.3 GI:556503834
atgtttacttattatcaggcagaaaattcaacagcagaacccgctctggttaatgccatt
gagcaaggccttcgggcacagcatggtgttgtcactgaagatgacattctcatggagctg
accaaatgggttgaagcttctgataacgacatcctcagtgatatctaccagcaaacgatc
aattatgtggtcagtggccagcaccctacgctttaa
              
                            

Download fasta file
RegulonDB