RegulonDB RegulonDB 10.7: Gene Sequence
ddpF gene sequence


Size: 927        A: 206  T: 215  G: 261  C: 245

Fasta

 

>ddpF E. coli K12. Version NC_000913.3 GI:556503834
gtgtctgacacgttattaacgttacgcgacgtccatatcaatttcccggcccgtaaaaac
tggcttggtaaaactacggaacatgttcatgccattaatggtattgatttacagatccgc
cgtggtgaaaccttagggatcgtcggcgagtcaggctgcggcaaaagcaccctcgcacag
cttttaatgggtatgctgcaaccgagccacgggcagtacatccgttctggctcacaacgc
attatgcagatggtgtttcaggacccgctctcttcgcttaatccgcgcttaccggtgtgg
cgcatcatcacagaaccgctctggatagctaagcgtagtagtgaacaacagcggcgagcg
ttggcagaggagttggctgtgcaggtgggtattcgtccggagtatctcgaccgcctgcct
catgcgttctccggcgggcagcggcaacgtatcgccattgccagagcactctcttcgcag
cctgacgtgattgtgcttgatgagccaacctctgcgctggatatctccgttcaggcgcag
atcctcaatttactggtaacgctacaggaaaatcacgggctgacctatgtgctgatttca
cacaatgtctcggtgatacgtcatatgagcgatcgggtggcggtgatgtatctcgggcag
attgtagaactgggcgacgcgcagcaggtgctgacggcacctgcacatccatacacccga
ttattgctggattccctccccgccattgataaaccgctggaggaagaatgggcattacgt
aaaacggatctgccgggaaaccgcacgttgccgcaaggctgttttttctacgaacgttgc
ccgctggcaacccacggatgtgaagtccggcaatcattagcaataagggaggacggacgt
gagctccggtgctggcgggcgctgtag
              
                            

Download fasta file
RegulonDB