RegulonDB RegulonDB 10.8: Gene Sequence
ddpD gene sequence


Size: 987        A: 221  T: 232  G: 279  C: 255

Fasta

 

>ddpD E. coli K12. Version NC_000913.3 GI:556503834
atgacccaacccgttctggacattcaacaactgcatttgagtttccccggttttaacggt
gatgttcacgcgctcaacaatgtgtccttgcagattaaccgcggtgaaattgtcggtctg
gtgggagaatccggctcaggtaaatcagtcaccgcaatgctgattatgcgtctgctaccg
acgggcagttattgcgtacatcgggggcagatttccctgctgggagaagatgttcttaac
gcgcgggaaaaacagcttcgtcagtggcgcggcgcacgagtggcgatgatctttcaggaa
ccgatgaccgccctcaatccgacacgtcgaataggtcttcagatgatggacgtgatccgc
catcatcaaccaataagtcgtcgggaagccagagctaaagcgattgacctgctggaagag
atgcaaatcccggatgccgtggaagttatgtcgcgctatccgtttgagctttcaggtggt
atgcgccagcgggtaatgattgcgctggcattctcctgcgagccgcaattgattattgcc
gacgaaccgactacggcgctggacgtcacggtgcagttgcaggtactgcgtttgcttaaa
cataaagcccgcgccagtggaactgcggttctgttcatcagccatgatatggccgtggtg
tcgcaactgtgcgatagcgtttacgtgatgtatgccggaagcgtaattgaaagcggcgtg
acggcagacgttatccatcatccccggcatccgtataccattggtttgctgcaatgcgca
ccagaacatggagtaccacgccagctattacccgccattccagggacggtaccaaacctc
acccatttgcctgacggctgcgcttttcgcgatcgttgctatgcggcaggtgcacagtgt
gaaaacgtcccggcgctgacagcgtgtggtgacaacaaccagcgctgtgcctgttggtat
ccgcagcaggaggttataagtgtctga
              
                            

Download fasta file
RegulonDB