RegulonDB RegulonDB 10.8: Gene Sequence
ddpB gene sequence


Size: 1023        A: 172  T: 289  G: 303  C: 259

Fasta

 

>ddpB E. coli K12. Version NC_000913.3 GI:556503834
gtgaccttctggagtattttacgccaacgctgctgggggctggtgctcgtggtggcgggc
gtctgcgtgattacgtttattatctcgcatctgatccctggtgatccggcgcggttactg
gcgggtgaccgcgccagcgatgctatcgtggaaaatattcgccagcaactgggactggac
cagccactgtatgtacagttttaccgctacgtcagcgacctgtttcatggtgacctggga
acatccattcgtaccgggcgtccggtgctggaagagttgcgtatatttttcccggcgacg
ctggagctggcttttggtgccctgctgctggcactcctgattggcatcccgctgggcata
ctctctgcagtctggcgaaatcgctggctggatcatctggtgcgaataatggccattacc
ggaatctccacacctgcgttctggcttgggctgggcgtcattgtgctgttttatggtcat
ctgcaaattcttcccggcggcggaaggcttgatgactggctggatccaccaacgcacgtt
accggcttttatctgctcgatgcgctgcttgaaggcaacggtgaagtcttcttcaatgcg
ttgcaacatctcatcttaccggcattaacgctggcgttcgttcacctgggaattgtcgct
cgccagatccgctcagcgatgctggaacaattgagtgaagactacattcgtaccgcccgg
gccagcggcttgcccggctggtatatcgttttatgttatgcgctacccaatgcgttgatc
ccatcgattaccgtattgggtttggcgctgggcgatttgttgtatggcgcagtgctcacc
gaaaccgtttttgcctggcccggaatgggtgcatgggtagtaacatcaatacaggcgctc
gacttcccggcagtgatgggctttgccgtcgtggtttcatttgcttatgtgctggtcaac
ctggtggtggatttgctctatttgtggattgatccgcgtatcggacgtggaggtggtgaa
tga
              
                            

Download fasta file
RegulonDB