RegulonDB RegulonDB 10.8: Gene Sequence
ddpX gene sequence


Size: 582        A: 132  T: 142  G: 149  C: 159

Fasta

 

>ddpX E. coli K12. Version NC_000913.3 GI:556503834
atgtcggataccaccgaactggttgatttagccgtaatcttccctgatctggagatcgaa
ttgaaatacgcctgcgctgataacatcacaggtaaagctatttatcagcaagcgcgttgt
ctgttacacaaggatgcgattaccgcgctggcgaaaagtatcagcatcgcccagctgtca
gggttacaactggtgatttacgatgcgtatcgcccacaacaagcacaggcgatgttgtgg
caagcctgcccagacccgcaatatgttgttgatgtgacggtcggttctaatcacagccgt
ggcacggcgatcgacctgacgcttcgtgatgagcacgggaacatcctcgatatgggcgca
gggttcgatgaaatgcacgagcgctcccatgcctatcacccttccgtcccgcccgccgct
cagcgcaatcggctgttgctgaatgcgataatgactggtggcggttttgtcggtatctcc
agcgaatggtggcacttcgaattaccccaggcagcgagttaccctctgctcgctgatcaa
ttctcttgttttatatcccctggcacacagcacgtcagttaa
              
                            

Download fasta file
RegulonDB