RegulonDB RegulonDB 10.8: Gene Sequence
dosP gene sequence


Size: 2400        A: 625  T: 570  G: 612  C: 593

Fasta

 

>dosP E. coli K12. Version NC_000913.3 GI:556503834
atgaagctaaccgatgcggataatgccgccgatggcatttttttccccgcccttgagcaa
aatatgatgggtgcggtgttaattaacgaaaatgatgaagtgatgtttttcaaccccgcc
gcagagaagctctggggatacaaacgtgaagaagtcattggcaataacattgatatgctg
attccgcgggatttgcgtcctgcgcatcctgaatacattcgtcacaaccgtgaaggcggt
aaagcgcgtgttgaggggatgagtcgggagctgcagctggagaaaaaagacggcagtaaa
atctggacccgttttgcgctatcgaaagtgagcgccgaggggaaagtttattacctggcg
ctggtacgggatgccagcgtagaaatggcgcaaaaagaacagacccgacaattgattatt
gccgttgaccatctcgaccgaccggtgattgtcctcgatccggaacgccatattgtgcag
tgcaatcgcgcatttaccgaaatgtttggttactgcattagcgaagccagcggtatgcag
cccgatacactcctgaacattcctgaattccctgccgataaccgcattcgtttacaacag
ttgctatggaaaaccgcccgcgatcaggacgaatttctgctgttgacgcgcaccggtgaa
aaaatctggattaaagcctctatcagcccggtttatgacgtgctcgcgcatctgcagaac
ctggtaatgactttctcggatatcaccgaagaacggcagattcgccagcttgaaggcaat
attctcgccgccatgtgcagcagcccgccatttcatgaaatgggggaaatcatttgtcgt
aacatcgaatctgtactcaacgaatcgcatgtttcgctgttcgcactgcgcaacgggatg
ccgatacactgggcgtcatcttcccacggtgcagaaattcaaaatgcgcaaagctggtca
gcgaccattcgtcagcgtgatggcgcgcctgcggggatcctgcaaattaaaacctcgtca
ggagcagaaaccagcgcctttatcgaacgcgtggcagatatcagccagcatatggccgcg
ctggcgctggaacaggaaaaaagccgtcagcatattgaacaactcatccaatttgatccg
atgaccggtctgccaaatcgcaataacctgcacaattacctcgatgacctggtcgacaaa
gccgtctctcccgtggtgtatctcatcggtgttgaccatattcaggatgtgattgatagc
cttggctatgcgtgggccgatcaggcattgctggaagtggtcaatcgctttcgtgaaaaa
ctcaaaccggatcagtatctctgtcgtatcgaaggtacgcagtttgtcctcgtgagcctc
gaaaacgacgtcagtaacattacccaaatcgccgatgagctacggaatgtggtcagcaag
ccgataatgattgacgataaacccttcccgcttaccttgagtattggcatcagctacgac
ctgggtaaaaaccgcgattacttgctctccactgctcacaatgcaatggattatattcgc
aagaatggcggtaacggctggcagttcttcagcccggcgatgaacgaaatggtaaaagag
cgtttggttttaggcgcagcgctgaaagaagcgattagcaataaccaactgaaactggtt
taccagccgcaaatcttcgcagaaacgggtgaactgtacggcatcgaagcccttgctcgc
tggcacgatcccctgcatggtcatgtgcccccttcacggtttattcctctcgcagaagag
attggtgaaatcgaaaatattgggcgctgggtcatcgcggaagcttgccgtcagttagca
gaatggcgtagccagaatattcatatcccggcgttatccgtgaacttgtcggcgctgcac
tttcgcagtaatcaactgcctaatcaggtgtctgatgcaatgcacgcctggggtattgac
ggccaccagctgacggtagaaatcacggaaagcatgatgatggaacacgataccgaaatc
tttaagcgcattcagatcctgcgtgatatgggcgtgggcttatcggtagatgattttggt
acgggcttttccggattatcccgcttagtcagtcttccggtaacggaaatcaaaattgac
aaaagttttgtcgatcgttgtctgaccgaaaaacgcatccttgccttacttgaagccatt
accagcattgggcaaagcctcaatttaaccgtcgtggcggaaggcgtcgaaaccaaagag
caatttgagatgctacgcaagatccactgtcgcgttattcagggatatttcttttcccgc
cccctacccgccgaagaaattccaggctggatgagcagcgtgttaccgctgaaaatctga
              
                            

Download fasta file
RegulonDB