RegulonDB RegulonDB 10.8: Gene Sequence
dosC gene sequence


Size: 1383        A: 395  T: 374  G: 324  C: 290

Fasta

 

>dosC E. coli K12. Version NC_000913.3 GI:556503834
atggagatgtattttaaaagaatgaaagatgagtggaccggacttgtcgaacaggcagat
ccgcccattcgtgctaaagccgcggaaattgccgttgcgcatgctcattatctgagtatc
gagttttatcgaattgtccgcatcgacccgcatgccgaagaattcttgagtaatgaacaa
gttgagcggcagttgaagagtgcgatggaacgctggattattaacgtgctttctgcccag
gttgacgatgtcgaaaggctaatacaaatccagcataccgtcgcggaagtgcatgcccgc
ataggaattccggtagaaattgtcgagatggggtttcgggtgctgaaaaaaatcctctat
ccggtgatcttctcttcggattattccgccgcagaaaaacttcaggtctaccatttctcg
attaacagtattgatatcgcgatggaagtgatgactcgcgcgtttacctttagtgacagt
agtgcctcaaaggaagatgaaaactatcgtatcttctcgttactggaaaacgccgaagaa
gaaaaagaacggcaaatagcctcaatactttcatgggaaatagatattatctataaaatc
ctgctggattctgatttaggcagtagtttgcctttaagccaggctgattttggcctgtgg
tttaaccataaaggtcgacattattttagtggtattgccgaagtaggccatatctcccgt
ctgattcaggatttcgacggtattttcaatcaaaccatgcgtaacaccagaaatttgaat
aacagaagtctgcgggtgaaatttttattacagataagaaataccgtatcgcaaattatt
accttgctgcgtgaattgtttgaagaagtatcgcgccacgaagtcggtatggatgtactg
acgaaattacttaaccgccgtttcctaccgactatcttcaaacgcgaaattgcccatgcc
aaccggaccggtacaccgctgtcagtgctgattattgacgttgataaattcaaagagatc
aacgatacgtggggccataacactggtgatgaaattctgcgtaaagtctctcaggccttt
tatgacaacgtccgcagtagtgattatgttttccgctacgggggcgatgaatttatcatt
gttttgactgaagcttctgaaaacgaaacgttacgtaccgcagaacgtattcgcagtcgg
gtggagaaaaccaaactgaaagccgcaaacggcgaagatattgccctctcactttccatc
ggtgccgccatgtttaatggtcatcctgactatgagcgcctcattcaaatagccgatgaa
gctctgtatatcgccaaaagacgaggtagaaaccgtgttgaactctggaaagccagtctt
tag
              
                            

Download fasta file
RegulonDB