RegulonDB RegulonDB 10.7: Gene Sequence
gadC gene sequence


Size: 1536        A: 338  T: 459  G: 374  C: 365

Fasta

 

>gadC E. coli K12. Version NC_000913.3 GI:556503834
atggctacatcagtacagacaggtaaagctaagcagctcacattacttggattctttgcc
ataacggcatcgatggtaatggctgtttatgaataccctaccttcgcaacatcgggcttt
tcattagtcttcttcctgctattaggcgggattttatggtttattcccgtgggactttgt
gctgcggaaatggccaccgtcgacggctgggaagaaggtggtgtcttcgcctgggtatca
aatactctggggccgagatggggatttgcagcgatctcatttggctatctgcaaatcgcc
attggttttattccgatgctctatttcgtgttaggggcactctcctacatcctgaaatgg
ccagcgctgaatgaagaccccattaccaaaactattgcagcactcatcattctttgggcg
ctggcattaacgcagtttggtggcacgaaatacacggcgcgaattgctaaagttggcttc
ttcgccggtatcctgttacctgcatttattttgatcgcattagcggctatttatctgcac
tccggtgcccccgttgctatcgaaatggattcgaagaccttcttccctgacttctctaaa
gtgggcaccctggtagtatttgttgccttcattttgagttatatgggcgtagaagcatcc
gcaacccacgtcaatgaaatgagcaacccagggcgcgactatccgttggctatgttactg
ctgatggtggcggcaatctgcttaagctctgttggtggtttgtctattgcgatggtcatt
ccgggtaatgaaatcaacctctccgcaggggtaatgcaaacctttaccgttctgatgtcc
catgtggcaccagaaattgagtggacggttcgcgtgatctccgcactgctgttgctgggt
gttctggcggaaatcgcctcctggattgttggtccttctcgcgggatgtatgtaacagcg
cagaaaaacctgctgccagcggcattcgctaaaatgaacaaaaatggcgtaccggtaacg
ctggtcatttcgcagctggtgattacgtctatcgcgttgatcatcctcaccaataccggt
ggcggtaacaacatgtccttcctgatcgcactggcgctgacggtggtgatttatctgtgt
gcttatttcatgctgtttattggctacattgtgttggttcttaaacatcctgacttaaaa
cgcacatttaatatccctggtggtaaaggggtgaaactggtcgtggcaattgtcggtctg
ctgacttcaattatggcgtttattgtttccttcctgccgccggataacatccagggtgat
tctaccgatatgtatgttgaattactggttgttagtttcctggtggtacttgccctgccc
tttattctctatgctgttcatgatcgtaaaggcaaagcaaataccggcgtcactctggag
ccaatcaacagtcagaacgcaccaaaaggtcacttcttcctgcacccgcgtgcacgttca
ccacactatattgtgatgaatgacaagaaacactaa
              
                            

Download fasta file
RegulonDB