RegulonDB RegulonDB 11.0: Gene Sequence
ydeO gene sequence


Size: 762        A: 229  T: 232  G: 152  C: 149

Fasta

 

>ydeO E. coli K12. Version NC_000913.3 GI:556503834
atgtcgctcgtttgttctgttatatttattcatcatgccttcaacgctaacattttagat
aaagattacgccttctctgacggcgagatcctgatggtagataacgctgttcgtacgcat
tttgaaccttatgagcggcattttaaagagatcggatttactgaaaataccattaaaaaa
tatctacaatgcactaacatccagacagtgacggtgcctgttcctgcgaagtttttacgt
gcttcaaatgtaccgactggattgcttaatgaaatgattgcttatctcaactcggaagaa
cgcaatcatcataatttttcagaacttttgcttttttcttgcctgtctatttttgccgca
tgcaaaggtttcattacactattaactaacggtgtgctatccgtttctgggaaagtgaga
aatattgtcaacatgaagccggcgcacccatggaagctgaaagatatttgtgactgcctg
tacatcagtgaaagcctgttgaagaaaaaacttaagcaagagcaaacgacattctcacag
attcttttagatgcaagaatgcagcacgcaaaaaatttgatacgcgtagaaggttcagtc
aataaaattgccgaacaatgtggttatgccagtacatcttattttatttatgcgttccgc
aaacatttcggcaacagtccgaagagagtttctaaggagtaccgttgtcaaagtcacacg
ggtatgaatacgggcaacacgatgaatgctttagctatttga
              
                            

Download fasta file
RegulonDB