RegulonDB RegulonDB 10.8: Gene Sequence
lsrD gene sequence


Size: 993        A: 170  T: 294  G: 277  C: 252

Fasta

 

>lsrD E. coli K12. Version NC_000913.3 GI:556503834
atgcgtattcgctacggttgggaactggctcttgccgcactgctcgttattgagattgtc
gcatttggtgcaattaacccgcgaatgttagatctcaatatgttgctgttcagcaccagt
gactttatctgcattggcattgtcgccctaccgctaacgatggtgattgtcagtggcggg
atcgatatttcgtttggttcgaccatcggcctctgcgccattgcattgggcgtactgttt
caaagtggtgtgccgatgccgctggcgatactcctgaccttactgctcggcgcattgtgc
gggctgatcaacgccggattaattatctataccaaagttaacccgctggtgattacgctt
ggcacgctgtatctgtttgccggaagcgctctgctgctttccggtatggccggagcgacg
gggtacgaaggtattggtggattcccgatggcgtttacagatttcgctaacctggatgtg
ctgggactccccgttccgctgattatcttcctgatatgtctcctcgttttctggctctgg
ctgcataaaacccatgccggacgtaatgtgtttttgattgggcaaagcccgcgcgtggcg
ctttatagcgcgattccagttaaccgtaccttatgtgcgctctatgccatgacggggctg
gcgtctgcggtcgccgctgtgctgctggtatcgtattttggttcagcacgttccgatctc
ggtgcgtcgtttctgatgcccgccatcaccgccgtggtgcttggcggggccaatatttat
ggtggttccggttccattatcggcaccgccattgcggttttattagtgggatatttgcaa
caaggtttgcaaatggcaggagtgccaaatcaggtgtccagcgccctttccggtgcgcta
cttatcgtcgttgtcgtaggtcgttccgttagcctgcatcgccagcaaattaaagagtgg
ctggcgcgtcgggccaataacccattgccataa
              
                            

Download fasta file
RegulonDB