RegulonDB RegulonDB 10.9: Gene Sequence
lsrB gene sequence


Size: 1023        A: 284  T: 231  G: 275  C: 233

Fasta

 

>lsrB E. coli K12. Version NC_000913.3 GI:556503834
atgacacttcatcgctttaagaaaatcgccttacttagcgctcttggcattgccgcaatc
tctatgaatgtgcaggccgcagagcgtattgcatttattcccaaactggttggcgtggga
ttttttaccagcggtggcaacggcgcacaacaagcgggtaaagagctgggcgttgatgtg
acctacgacgggccgacagaacccagtgtttctggtcaggtacagttgattaataacttc
gtcaatcaaggttataacgccattatcgtttctgcggtttcgcctgatggcttgtgtccg
gcactgaaacgcgccatgcaacgtggtgtgagagtgctgacctgggactctgatactaaa
ccggagtgccgctcttactacattaatcagggaacgcccgcccagttaggaggtatgttg
gtggatatggcggcgcgtcaggtgaataaagacaaagccaaagtcgcgtttttctactca
agccccaccgttacggaccaaaaccagtgggtgaaagaagcgaaagcgaaaatcgccaaa
gagcatccaggctgggaaattgtcactacgcagtttggctataacgatgccactaaatcg
ttacaaaccgcagaaggaatattaaaagcgtatagcgatctcgacgccattatcgccccc
gatgccaacgccctgcccgctgccgcacaagccgcagaaaacttgaaaaatgacaaagta
gcgattgtcggattcagtacgccaaatgtgatgcgcccgtatgtagagcgcggcacggtg
aaagaatttggcctgtgggatgtggttcagcaaggcaaaatttcagtgtatgtcgcggat
gcattattgaaaaaaggatcaatgaaaacgggcgacaagctggatatcaagggcgtaggt
caggttgaagtctcgccaaacagcgttcagggctatgactacgaagcggatggtaatggc
atcgtactgttaccggagcgcgtgatattcaacaaagagaatatcggcaaatacgatttc
tga
              
                            

Download fasta file
RegulonDB