RegulonDB RegulonDB 11.0: Gene Sequence
dgcF gene sequence


Size: 948        A: 209  T: 261  G: 266  C: 212

Fasta

 

>dgcF E. coli K12. Version NC_000913.3 GI:556503834
ttgcttgcggactggttcagtgagcaattctcaacgggcgtgttgatcgtgccttgtatg
ctgacgttggctattcctggagtgctgccgcgctttaaagcagaacagatgatgcccgcc
atcgcgcttattgtgtcggttattgcctcggtagtcattggcggagcggggagtctggcg
ttcccgctgcctgcattaatctggtgtgcagtgcgctatacgccgcaggtaacatgtctg
ttgacctttgtcaccggtgcggtggaaatcgtactggtggcaaattcggtgattgatatc
tcggtcggttcgccgttctccattccgcaaatgttctccgcacgtctcggtattgccacg
atggcgatatgcccaattatggtttcttttagcgtggcagcgatcaattcgctaatgaag
caagttgcgctgcgagccgactttgattttctgactcaggtttactcacggtccggtctt
tatgaggcgctgaaaagtccatcgctgaaacagacacaacatctgactgtcatgctgctt
gatatcgactatttcaaaagcattaacgataactatggacatgaatgtggcgataaagtg
ttaagcgtgtttgcccggcatattcagaagattgtcggtgataaggggctggtggcgcga
atgggcggcgaagaatttgctgttgcagtgccgtcggtgaatcctgtcgatggtctgcta
atggcggaaaaaatccgtaaaggcgttgaactgcaaccattcacctggcaacaaaaaacg
ctttatctcacggtaagtattggcgtcggtagtggtcgcgcatcgtacctaacgctgacc
gatgactttaataaattgatggtcgaagccgatacgtgtctgtatcgctcgaagaaagat
gggcgcaaccgtaccagcactatgcgttacggtgaggaagttgtctga
              
                            

Download fasta file
RegulonDB