RegulonDB RegulonDB 10.9: Gene Sequence
rzpQ gene sequence


Size: 498        A: 153  T: 117  G: 124  C: 104

Fasta

 

>rzpQ E. coli K12. Version NC_000913.3 GI:556503834
gtgaatcagatattcatggtgatttttctcgtgttgtcaggatttatcgtcggaaatgtc
tggagcgaccgaggatggcaaaaaaaatgggcggaacgtgatgctgccgcattatcacaa
gaggtaaatgctcaatttgctgctcgaataattgaacaggggcgaactatagcccgtgat
gaggctgttaaagatgcgcaacagaaatctgctgaaatttctgccagggctgcttatctg
tctgatagtgttaaccagttgcgtgccgaagcaaaaaaatatgccatacgccttgacgca
gcgaagcataccgcagatcttgccgctgccgtcagaggcaaaacaaccaaaaccgccgaa
ggaatgctcaccaacatgctcggagatattgcagcagaagctcagctttatgctgaaatt
gctgacgaacgctacatcgcaggagtgacttgtcaacagatctatgaatctttaagagat
aaaaagcatcaaatgtag
              
                            

Download fasta file
RegulonDB