RegulonDB RegulonDB 10.8: Gene Sequence
flxA gene sequence


Size: 333        A: 131  T: 59  G: 77  C: 66

Fasta

 

>flxA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgtcacaattcagggaaatacctcaaccgttatttcaaacaactccgccccggaa
ggaacatcagaaatagccaaaatcacaagacaaattcaggtgctgactgaaaagcttggg
aaaatctcatcggaagaggggatgacgacacagcagaaaaaagaaatggctgcattggta
cagaagcaaattgaaagcctctgggctcaactggagcagttgttaaggcagcaggcagag
aaaaagaatgaagacgcgacagttcagcctgataaaaaagaagagaaaaaagacgataca
aataccgctggcaccattgatatttacgtctaa
              
                            

Download fasta file
RegulonDB