RegulonDB RegulonDB 10.9: Gene Sequence
ynfF gene sequence


Size: 2424        A: 652  T: 531  G: 628  C: 613

Fasta

 

>ynfF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatccataccacagaggcgctcatgaaggctgaaatcagccgtagaagtctgatg
aaaacctccgcacttggcagtcttgcgctggcaagcagtgctttcactctgccattttcc
caaatggtccgggcggcagaggctccggtagaagagaaagcggtctggagttcctgcacc
gttaactgcgggagccgctgtctgttacgtttgcatgtgaaagatgacaccgtgtactgg
gtggagtctgatacgacaggtgacgacgtctacggtaatcatcaggttcgagcgtgttta
cgcgggcgctctatccgccgacggatgaatcatcctgataggttgaaatatcccatgaag
cgcgtcggcaagcgcggtgaaggtaaatttgaacggataagttgggacgaagccctggat
accatcagtgataatcttcggcggatcctgaaagattacggcaatgaggctgtacatgtc
ctgtacggaacaggcgtagatggcggaaacatcaccaactcaaacgtcccgtaccgtctg
atgaactcttgcggtggttttctcagtcgctatggcagctacagtaccgcacagatcagt
gccgcaatgagttatatgttcggtgccaatgatggcaacagcccggatgatatcgccaat
acgaaactggtcgttatgttcggaaataacccggcagaaacgcggatgagcggcggtggt
gtcacttactacgtcgagcaagcccgcgaacgttcaaacgcacgcatgatcgtcatcgat
ccacgttataacgacactgctgccgggcgtgaagatgaatggctgcccattcgccctggc
accgatggcgcactggcctgtgcgattgcctgggtactgattactgaaaacatggtcgat
cagccatttctcgacaaatattgtgttggttacgatgaaaaaacgctgcccgccaacgca
ccacgtaacgcgcattataaagcctatattctgggcgaagggcctgacggcatagctaaa
acgccggaatgggcagcaaaaatcaccagcatcccggcagaaaaaattatccagttggca
cgagagatcggttcagcaaaacctgcttatatttgtcagggttgggggccacaacgacat
tccaacggcgagcaaacatcccgcgctattgccatgctttccgttctcaccggcaacgtc
ggcataaacggcggcaactcaggcgtacgcgaaggtagctgggatctgggggtagaatgg
ttcccgatgctcgagaatcctgttaaaacgcagatttccgtctttacatggacagatgcc
atcgaccatggtacggaaatgaccgcgacccgtgatggtgttcgtggaaaagaaaaactg
gatgtccccatcaagtttttatggtgctacgccagtaacacattgatcaatcaacatggc
gacatcaatcacacccatgaggtgcttcaggatgacagcaagtgcgagatgattgttggc
attgaccacttcatgacggcctcggctaagtattgcgatatcctgttgcccgacctgatg
ccaacagagcaagaagaccttatctctcatgaatctgcagggaatatgggctatgtgatc
ctcgcccaacccgcaacctcagcaaaatttgaacgcaaacccatctactggatgctgagt
gaagtcgccaaacgcttaggaccagacgtttatcaaacctttactgaaggtcgcagtcag
catgaatggatcaaatatctccatgcgaaaacgaaggaacgtaaccctgagatgcccgac
tacgaggagatgaaaacgaccgggatctttaagaaaaaatgcccggaagaacactacgtc
gctttccgcgcattccgtgaagatccacaggcaaacccgttgaaaacaccttcggggaaa
atcgaaatttattctgaacgactggcgaagattgcagatacctgggaattgaaaaaagat
gaaattattcatccccttcctgcgtataccccaggttttgatggctgggacgatcccctg
cggaaaacctatccactgcagttaacgggcttccattacaaagcgcgtacccactccagc
tacggcaatattgatgtgttacagcaggcctgcccacaagaggtgtggatcaaccccatt
gatgctcaggcacgcggtatccgtcatggcgataccgtgcgggtatttaacaataatgga
gaaatgctgattgccgcaaaagtgactccgcgtattctgcctggcgttaccgccatcggg
caaggtgcgtggcttaaagcggatatgtttggtgaccgggtcgatcacggcggcagtatc
aatattctgacctctcaccgcccttcaccgctggcaaagggaaacccgtcgcacagcaat
cttgtccagatcgaaaaggtttaa
              
                            

Download fasta file
RegulonDB