RegulonDB RegulonDB 10.8: Gene Sequence
ynfG gene sequence


Size: 618        A: 147  T: 144  G: 161  C: 166

Fasta

 

>ynfG E. coli K12. Version NC_000913.3 GI:556503834
atgaccacacaatatggattttttatcgattccagccgctgtactggctgtaaaacctgc
gaactggcgtgcaaagattttaaagatcttggcccggaagtcagtttccgccgtatttat
gaatacgctggcggcgactggcaggaagataatggcgtctggcaccagaacgtgttcgct
tattatctctccatctcctgtaaccattgcgatgaccccgcatgtacaaaagtctgcccc
agcggcgcaatgcataagcgtgaagatggctttgtggtggttgatgaagatgtttgtatc
ggctgccgctactgccacatggcttgtccgtacggcgcgccacagtacaatgctgaaaaa
gggcacatgacgaagtgcgatggttgttattcgcgcgtcgccgaggggaaacaacccata
tgtgtcgaatcctgcccgctgcgtgcacttgagttcggtccaattgaagagctgcgccag
aagcacggcactcttgctgccgtcgcgccactgccgcgcgcgcatttcacaaaacccaat
atcgttatcaaacctaacgccaacagccgcccgaccggcgataccactggttatctggct
aatccggaggaagtgtaa
              
                            

Download fasta file
RegulonDB