RegulonDB RegulonDB 10.8: Gene Sequence
mdtI gene sequence


Size: 330        A: 54  T: 106  G: 100  C: 70

Fasta

 

>mdtI E. coli K12. Version NC_000913.3 GI:556503834
atggcgcagtttgaatgggttcacgccgcctggctggcattggcaatcgtgctggaaatc
gttgctaacgtctttttgaaattttctgacggctttcgtcgcaaaatatttggcttgctc
tccctggcggcggtgctggctgcctttagtgcgctttctcaagccgttaaagggatcgac
ttgtctgtcgcttatgcattgtggggcgggtttggtattgccgccacgttagccgcaggt
tggatcttgtttggtcaacggttaaatcgtaaaggctggattggcctggtcttgctgttg
gctggaatgatcatggtgaaacttgcctga
              
                            

Download fasta file
RegulonDB