RegulonDB RegulonDB 10.9: Gene Sequence
anmK gene sequence


Size: 1110        A: 237  T: 267  G: 322  C: 284

Fasta

 

>anmK E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcgggccgctttattggcgttatgtcaggcaccagccttgatggtgttgatgtt
gtgttggcgacaattgatgaacaccgggtcgcacagctggcaagtttgagttggccgatc
ccggtatctctgaaacaggctgtactggatatttgccagggccagcagcttacactttcg
cagtttggacagcttgatactcaactcgggcaactttttgctgatgcggtcaatgccttg
cttaaggaacaaaatctgcaggcaagagatatagttgcgatcggttgtcacggtcaaacc
gtctggcatgaaccgacgggcgtggcaccacacactttacagattggcgataacaatcaa
attgtggcacgcaccggaattacggttgtcggtgattttcgccgtcgcgatattgccttg
ggaggacaaggcgcaccgctggtacctgcgttccatcatgcgctgctggctcacccaacc
gagcgacgaatggtgctcaatattggcggcatcgccaatctgtcactgctcattcctggg
cagccggttgggggctacgataccggtcctggtaacatgctgatggatgcctggatctgg
cgtcaggccggtaaaccttacgataaagatgccgagtgggcacgggcgggtaaagttatt
ctcccactgctgcaaaatatgctcagcgacccgtatttctcgcaacctgcaccgaaaagc
accggacgcgaatactttaactatggttggctggagcgccatttgcgccattttccgggt
gttgatccccgagatgtgcaggcgacactggcagaactcaccgccgtgaccatttctgaa
caagttttgttgagcggtggctgcgaacgattgatggtatgtggtggaggtagtcgtaat
ccgctactcatggcgcgtctggcggcattactgccaggcacagaagtcaccaccaccgat
gccgttggcattagtggcgatgacatggaagcattggctttcgcctggcttgcctggcgg
acgctggcgggattaccaggaaatctgccttccgtcactggcgcaagccaggagacggta
ctgggggctattttccccgctaacccgtga
              
                            

Download fasta file
RegulonDB