RegulonDB RegulonDB 10.9: Gene Sequence
slyB gene sequence


Size: 468        A: 106  T: 122  G: 140  C: 100

Fasta

 

>slyB E. coli K12. Version NC_000913.3 GI:556503834
atgattaaacgcgtattggttgtttcaatggtaggtctgtctcttgtcggttgtgttaat
aacgacaccctgtcaggggatgtttataccgcttctgaagcgaaacaagtacagaatgtc
agctatggcaccatcgttaacgtacgtccggtacagattcagggcggtgatgattccaac
gttatcggtgcaattggcggtgctgttcttggtggtttcctggggaatactgttggtggc
ggaaccgggcgttctctggctactgcagcaggcgctgttgcaggtggcgtagctggtcag
ggcgtacagagtgcaatgaacaaaacgcagggtgtcgagctggaaattcgtaaagacgat
ggtaataccatcatggtggtacagaaacaaggcaacactcgtttctctccgggccaacgt
gtcgtactggccagcaatggcagtcaggtgaccgtttctccgcgctaa
              
                            

Download fasta file
RegulonDB