RegulonDB RegulonDB 10.9: Gene Sequence
slyA gene sequence


Size: 435        A: 130  T: 95  G: 106  C: 104

Fasta

 

>slyA E. coli K12. Version NC_000913.3 GI:556503834
ttggaatcgccactaggttctgatctggcacggttggtgcgcatatggcgtgctctgata
gaccatcgcctgaaaccgctggagttaacacaaacccattgggttacgttacacaatatc
catcagttacctccagaccagtcgcaaattcaactggcaaaagcgattggcatcgagcag
ccatcactggtccgtactctggaccaactggaagaaaaagggttaatttcgcgtcaaact
tgtgccagcgatcgtcgggctaaacgtattaaactgacggaaaaggcagagccgctgatc
agcgaaatggaagctgttattaacaaaacccgcgcggaaatattacatggcatctccgca
gaggaactggagcaactgattacgctcatcgcaaaacttgagcataatatcattgagtta
caggccaaagggtga
              
                            

Download fasta file
RegulonDB