RegulonDB RegulonDB 10.8: Gene Sequence
ydhI gene sequence


Size: 237        A: 38  T: 83  G: 59  C: 57

Fasta

 

>ydhI E. coli K12. Version NC_000913.3 GI:556503834
gtgaagtttatgctcaatgcaacaggattgcccttacaagatctggtgttcggtgcgtcc
gtctactttcctccgtttttcaaagcattcgcgtttggattcgtcatctggcttgtcgta
caccgcctgcttcgtggctggatctacgccggtgacatctggcatcccttgttaatggat
ttatcgctgtttgcgatttgcgtttgccttgctctggcaatactgattgcgtggtaa
              
                            

Download fasta file
RegulonDB