RegulonDB RegulonDB 10.8: Gene Sequence
ydhX gene sequence


Size: 669        A: 166  T: 166  G: 172  C: 165

Fasta

 

>ydhX E. coli K12. Version NC_000913.3 GI:556503834
atgtccttcactcgacgcaaatttgttctggggatgggaacagtaatcttttttactggt
tctgcgtcttctctgttagcgaacacgaggcaagaaaaggaagttcggtatgccatgatt
catgacgagtcacggtgcaatggctgtaatatttgcgcccgcgcatgccgtaaaactaac
cacgtccccgctcagggaagccgtttatcgatagcacacattccagtcaccgataacgac
aacgaaacgcagtatcacttttttcgccagtcatgtcagcactgcgaagatgctccgtgc
atcgacgtttgcccgacgggggcgtcgtggcgtgatgagcaggggatcgtgcgggtagaa
aaatcgcagtgcatcggctgcagttattgcattggcgcttgtccgtaccaggttcgctac
cttaaccctgtcactaaagtggcagataaatgtgatttctgcgctgagtcccgactggca
aaaggctttccgcccatttgcgtcagcgcctgcccggaacacgcattgatctttggtcgc
gaagatagcccagaaattcaggcgtggttgcagcaaaataaatactatcaatatcagcta
cctggtgccgggaaaccgcatctgtatcgccggttcggtcaacatttgattaaaaaggaa
aatgtatga
              
                            

Download fasta file
RegulonDB