RegulonDB RegulonDB 10.8: Gene Sequence
ydhW gene sequence


Size: 648        A: 154  T: 155  G: 191  C: 148

Fasta

 

>ydhW E. coli K12. Version NC_000913.3 GI:556503834
atgggtaagatgaaccatcaggatgaattgccgttagcgaaagtcagcgaagttgacgag
gcgaagcggcaatggttgcaggggatgcgtcaccccgttgatacggtaaccgaaccagaa
cctgctgaaatcctggctgagttcattcgccagcattctgcggctgggcagctggtggcg
cgcgccgtgtttctctcgccaccctatttggttgcagaagaggaactgtcagttttgctg
gaaagcattaagcagaacggagactacgcggatatcgcttgtttgacgggaagcaaggat
gattactattactcaacgcaggccatgagtgaaaactacgcggcgatgtctttgcaagtt
gtggagcaggacatttgtcgcgccattgcacacgccgttcgttttgagtgccagacgtat
cctcgtccttacaaagtcgccatgctgatgcaagcgccatattacttccaggaagcgcag
attgaagccgcgatcgccgcgatggatgttgcacctgaatatgccgatatacggcaggtg
gagtcatcgacggcggtgttgtacttgtttagcgagcgatttatgacctatggcaaggct
tatggcttatgcgaatggttcgaggtagagcagtttcagaacccctga
              
                            

Download fasta file
RegulonDB