RegulonDB RegulonDB 10.8: Gene Sequence
ydhV gene sequence


Size: 2103        A: 568  T: 526  G: 550  C: 459

Fasta

 

>ydhV E. coli K12. Version NC_000913.3 GI:556503834
atggctaacggttggacaggtaatatattaagagtcaatctcacgacaggaaatattacc
ctcgaagattccagtaagtttaaaagttttgtcggtggcatgggcttcggctacaaaatt
atgtatgacgaagtaccgccaggcacgaaacctttcgatgaagcgaataaattagtcttt
gctaccggcccattaactggatctggtgccccctgtagttctcgcgtaaatatcacctca
ctttctacttttaccaaaggaaatttagtcgtcgatgcccatatgggtggcttttttgca
gcgcaaatgaaattcgctggatacgacgtcattattatcgaagggaaggcgaaatcaccg
gtatggctgaagattaaagatgacaaagttagcctggaaaaagccgatttcttatgggga
aaagggacgcgcgcaacgacggaagaaatttgtcgattgaccagtccggaaacctgtgtg
gcggctattggtcaggctggggaaaaccttgttcctctctctggcatgttgaatagccgt
aaccacagcggcggtgcgggaactggcgcaataatgggttcgaaaaacctgaaagcgatt
gcggttgaagggacgaaaggggtcaacattgccgatcgtcaggagatgaagcgtctcaat
gattacatgatgactgaacttattggtgcgaataacaaccatgtcgtgccaagtacgcca
caatcgtgggcagagtattcagatcccaagtcacgctggacagcacgtaaagggctgttt
tggggcgcggctgaaggtggtccgattgaaacgggtgaaattccgccaggcaatcagaat
acggtcggctttcgtacctataaatccgtttttgacttaggaccggcggcagagaaatac
acagtaaaaatgagcggctgccactcttgcccgatccgttgtatgacccaaatgaatatt
cctcgggtgaaagagtttggcgtgcccagcacaggtggtaacacttgtgtagcaaacttt
gtccataccaccatcttcccgaacgggccgaaagattttgaagataaagacgatggtcgt
gtgattggtaacctggtgggtctgaatttgttcgatgactacggcctatggtgtaactac
gggcagttgcatcgcgactttacttattgttacagcaaaggtgtgttcaagcgtgttctg
ccagctgaagagtatgcagaaattcgctgggatcaactggaagcgggtgacgttaacttc
attaaagatttttactaccgtctggcgcatcgtgtgggtgagctgagtcacctggctgat
ggttcatatgccatcgcagaacgctggaatttgggtgaagagtactggggctacgcgaaa
aataaactctggtcgccgtttggctatccggttcaccatgccaatgaagcgtcagcgcag
gtcggttccattgttaactgtatgttcaaccgtgactgcatgacgcatacccatatcaac
tttattggttccggcttgccattgaaactgcaacgtgaagtggcgaaagaactttttggt
tctgaagatgcttacgatgaaaccaaaaactacacgccaatcaatgacgcaaaaattaaa
tatgcaaagtggtcgctgttgcgggtctgtttgcataacgccgtcaccctgtgcaactgg
gtctggccaatgaccgtttcgccgctgaaaagccgtaattaccggggcgatctggcgctt
gaagccaaattcttcaaagcgatcaccggcgaagagatgactcaggaaaaattagattta
gctgcagagcgtatttttacgttgcatcgtgcctacacggtaaaactgatgcaaaccaaa
gatatgcgtaatgaacacgatcttatctgttcctgggtattcgacaaggatccgcagatc
ccggtctttactgaaggtactgacaaaatggatcgtgacgatatgcatgcttcgctcacg
atgttctacaaagaaatgggctgggacccacagcttggttgtccaacccgcgaaacattg
cagcgtctggggctggaagatattgccgccgatctggcagcacacaatctactgcctgcg
taa
              
                            

Download fasta file
RegulonDB