RegulonDB RegulonDB 10.8: Gene Sequence
ydiS gene sequence


Size: 1290        A: 297  T: 288  G: 377  C: 328

Fasta

 

>ydiS E. coli K12. Version NC_000913.3 GI:556503834
atgtcggatgacaaatttgatgccattgtggtcggtgcgggcgttgctggtagcgttgcc
gcactggtcatggcacgagccgggctggatgtcctggtgatagaacgcggcgacagtgcc
ggatgtaaaaacatgaccggcgggcgtctttatgcccacacacttgaagcaatcattcca
ggctttgcagtatcagcgccggtagaacgcaaggtcacacgcgagaaaatctccttctta
accgaagaaagcgccgttaccctcgattttcaccgcgagcagccagatgttccgcaacac
gcatcttataccgtattgcgtaatcgtctggacccgtggttgatggaacaagccgagcag
gcgggcgcgcagtttatcccaggcgttcgcgtcgacgcgctggttcgtgaaggaaacaag
gtcactggcgtgcaggctggggatgatattctcgaagcgaatgtggtgattctggctgat
ggcgttaactcgatgcttggccgctcgctgggaatggttcccgcttccgatccgcatcat
tacgctgttggtgttaaagaggttattggcctcacaccagaacagatcaacgatcgcttt
aatattacgggcgaggaaggtgccgcctggctgtttgccggttccccttctgacggcctg
atgggcgggggatttctctataccaacaaggattccatatccttggggctggtttgtgga
ttgggtgatatcgcccatgcgcaaaaaagcgtgccgcaaatgctggaagattttaaacaa
caccccgccattcgcccgctgattagcggcggcaaactgcttgaatattccgcgcatatg
gtgccggaaggcggtctggcaatggtgccgcaactggttaacgagggcgtgatgatcgtt
ggtgacgccgcaggcttctgcctgaatttgggttttacggtccgcggcatggatttagcc
attgcatcggctcaggctgccgccacaacggtgatcgccgccaaagaacgcgcggatttc
tccgccagcagtctggcgcaatacaaacgtgagctggaacaaagctgcgtcatgcgtgat
atgcagcattttcgcaagatcccggcgctgatggaaaacccgcgcctgtttagccaatac
ccacgaatggtagccgacatcatgaacgagatgttcaccatcgacggcaaaccaaaccag
ccggtacgaaaaatgatcatgggacatgcgaagaaaattgggctgatcaacttgctgaaa
gatggcattaagggagcaaccgcgctatga
              
                            

Download fasta file
RegulonDB