RegulonDB RegulonDB 10.8: Gene Sequence
ydiV gene sequence


Size: 714        A: 195  T: 217  G: 149  C: 153

Fasta

 

>ydiV E. coli K12. Version NC_000913.3 GI:556503834
atgaagatttttttggagaatctttatcattctgattgctatttcctgccgataagagac
aaccagcaagtccttgtcggcgttgagttaattacccatttctccagtgaagatggtacg
gttcgtatcccgacgagtcgggttatagcgcaacttaccgaggagcaacattggcaatta
ttttcagagcagttggaattactaaaatcatgccaacatttttttattcaacataaactc
tttgcctggcttaatttaacgccacaagtggctacattattattagagagggataattac
gcaggcgaactattaaaatatccgtttattgaactgttgattaatgagaattacccgcat
ctcaatgaaggaaaagataatcgcggtcttttatccttatcgcaagtgtatccccttgtg
ttaggtaatttgggagcaggcaatagcacaatgaaagcggtttttgatggtcttttcacc
cgcgtcatgctggataaaagttttattcagcaacaaatcacgcaccgctccttcgaaccg
tttattcgtgcgatccaggcgcaaatttccccttgttgcaattgcatcattgcgggaggc
attgatacggcagaaatattggcacagattacccccttcgatttccatgctctccaggga
tgcctgtggcctgccgttcccataaatcagataacgacgttggttcagcgataa
              
                            

Download fasta file
RegulonDB