RegulonDB RegulonDB 10.6.3: Gene Sequence
ynjD gene sequence


Size: 654        A: 144  T: 176  G: 171  C: 163

Fasta

 

>ynjD E. coli K12. Version NC_000913.3 GI:556503834
atgctctgcgtgaaaaatgtttcgctacgtttaccagaaagccgcttgctgacaaacgtt
aactttacggtggataaaggtgacattgtcacgttaatggggccgtctggctgtggaaaa
tccactctgttttcatggatgattggtgcactggccgaacagttttcttgtacaggtgag
ctatggctcaatgagcaacggattgacatcctacccaccgcacagcgtcagattggcatt
ctttttcaggatgcactgttatttgaccagttcagtgtcgggcaaaatttactgctggcg
ctaccggcgacacttaaagggaatgcccgacgtaatgccgtgaatgatgcacttgagcgt
tcaggccttgagggagctttccatcaggatcctgccactttgtctggcggtcagcgagcg
cgcgttgctctactacgcgcccttctcgcccaaccaaaagcgttactcctggatgagcca
ttcagccgtcttgatgtggctctgcgcgataattttcgccagtgggtgttcagcgaagtt
cgcgccctggcgatccccgtcgttcaggtaacgcacgatctccaggatgttcctgctgat
agttctgttctggatatggcgcagtggtcagaaaattacaacaaactgcgataa
              
                            

Download fasta file
RegulonDB