RegulonDB RegulonDB 10.8: Gene Sequence
yeaC gene sequence


Size: 273        A: 87  T: 63  G: 69  C: 54

Fasta

 

>yeaC E. coli K12. Version NC_000913.3 GI:556503834
atgaatcttgatgacattatcaacagcatgatgcctgaggtataccagcgtttgtcgacc
gccgttgaactggggaaatggcctgatggcgttgcgttgaccgaggaacaaaaagagaac
tgcctgcaactggtgatgctgtggcaagcccgccataatatcgaagcacagcatatgaca
attgacacaaatggtcagatggtcatgaagagcaaacagcagttaaaagaagattttggt
atctcagcaaagcctattgccatgtttaagtaa
              
                            

Download fasta file
RegulonDB