RegulonDB RegulonDB 10.9: Gene Sequence
yeaD gene sequence


Size: 885        A: 228  T: 216  G: 224  C: 217

Fasta

 

>yeaD E. coli K12. Version NC_000913.3 GI:556503834
atgattaagaaaatttttgcccttccggtcatcgaacaaatctcccctgtcctctcccgt
cgtaaactggatgaactggacctcattgtggtcgatcatccccaggtaaaagcctctttt
gcattacagggcgcacaccttctctcgtggaaacctgcgggtgaagaagaagttctgtgg
ttgagcaacaacacaccgttcaaaaatggcgtcgctattcgcggtggcgtaccggtttgc
tggccgtggtttggtccggcggcacaacaaggtctgcctgcgcacggttttgcccgcaac
ctgccgtggacgctgaaatcacatcatgaagatgctgatggcgtagcgctgacttttgaa
ttgacgcaaagcgaagagacgaaaaaattctggccgcacgactttacgctgttagcgcat
ttccgcgtgggtaaaacttgtgaaatcgatcttgaatcacatggcgaatttgaaaccacc
tctgccctgcatacctactttaacgtgggtgatatcgctaaggtaagcgtcagtgggctg
ggcgatcgcttcattgataaagtgaatgacgcgaaagaaaatgtactgaccgatggtatt
cagaccttccctgaccgtaccgatcgcgtgtatctgaatccacaagattgcagcgtgatt
aatgatgaagcgctgaatcgtattatcgccgtaggccaccagcatcatctgaacgttgtc
ggctggaacccgggaccggcgctttcaattagcatgggcgatatgccggatgatggctac
aaaacatttgtttgtgtagaaacggcttacgcttcagaaacgcaaaaagtgaccaaagag
aaacctgcacatctggcgcaatccattcgcgttgcgaaacgttaa
              
                            

Download fasta file
RegulonDB