RegulonDB RegulonDB 10.8: Gene Sequence
yeaR gene sequence


Size: 360        A: 99  T: 87  G: 85  C: 89

Fasta

 

>yeaR E. coli K12. Version NC_000913.3 GI:556503834
atgcttcaaatcccacagaattatattcatacgcgctcaacgcctttctggaataaacaa
actgcacctgccggaatattcgaacgtcatcttgataaaggaacgcgcccgggggtttac
ccacgcctttccgttatgcatggggcggtcaaatatctcggctacgctgatgaacacagt
gcagagcctgatcaggtgatccttatcgaagcggggcagtttgcggtgttccctccagaa
aagtggcacaacattgaagccatgactgacgatacttatttcaacattgacttcttcgtg
gctcctgaagtcctgatggaaggtgcgcaacaacggaaagtcattcataacgggaaatga
              
                            

Download fasta file
RegulonDB