RegulonDB RegulonDB 10.8: Gene Sequence
flhB gene sequence


Size: 1149        A: 248  T: 270  G: 344  C: 287

Fasta

 

>flhB E. coli K12. Version NC_000913.3 GI:556503834
gtgtctgacgagagcgacgacaaaacagaagcccccacacctcaccgactagaaaaagcg
cgggaagaggggcaaatcccgcgttcccgtgaactgacctcactgctgattttgctggtg
ggcgttagtgttatctggtttggcggtgtgtcgctggcccgtcgattgtcgggcatgctc
tccgctgggctgcattttgatcacagtattatcaatgacccgaatctgatcctcgggcag
attattctgctgatcagagaagccatgctggcgctgctgccgctgattagcggcgtggtg
ctggtggcgctcatttctccggtcatgctgggagggctggtatttagcggcaaatccttg
cagccgaagttttccaaactcaacccgctaccgggcattaaacggatgttctcggctcag
actggcgcggagttgcttaaagcaattttgaaaaccatcctggttggcagcgtgacgggg
ttttttctctggcatcactggccgcagatgatgcgcttgatggccgagtctccgattacc
gccatgggtaatgcgatggatttggtagggctatgcgcactgctggtggtgcttggtgtc
attccaatggtgggatttgacgtctttttccaaatattcagccacctgaaaaagctgcgt
atgtcacggcaggatattcgtgatgagttcaaacaaagcgaaggtgaccctcatgttaaa
gggcggatccgtcagatgcagcgagctgctgcacggcgtcggatgatggccgatgtgccg
aaagcggatgtcattgtcaataacccgacccactattcggtagcgttgcagtatgacgaa
aacaaaatgagcgcaccgaaagtggtcgctaaaggtgcagggctggtcgcgctgcgcatt
cgtgaaattggcgctgaaaataacgtcccgacgcttgaagcgccgccgctggcgcgagcg
ctgtatcgacatgcggagattggtcaacaaatcccgggtcaactgtacgccgcggtggcg
gaagtgctggcctgggtctggcaactgaaacgctggcgtctggctggtggacagcgccct
gtacaacctactcatcttccggtgccggaagccctggattttattaacgagaaaccgacc
catgagtaa
              
                            

Download fasta file
RegulonDB