RegulonDB RegulonDB 10.10: Gene Sequence
ftnB gene sequence


Size: 504        A: 142  T: 121  G: 116  C: 125

Fasta

 

>ftnB E. coli K12. Version NC_000913.3 GI:556503834
atggcaaccgctggaatgcttctcaaactcaactctcaaatgaaccgcgagttttacgca
tccaatctctaccttcacctgagtaactggtgttctgaacagagtctgaacggcaccgcc
actttccttcgcgcccaggcacagagtaatgtgacccaaatgatgcgcatgtttaacttt
atgaagagtgtcggcgctacccccatcgttaaagccattgatgttcccggtgaaaaactg
aactctctggaagaactgttccaaaaaacgatggaagaatacgagcaacgttctagtacg
ttggcacagttagccgatgaagcgaaagaactgaatgatgattcaaccgtcaatttcctg
cgcgatctggaaaaagaacagcagcatgatggtctgttgctgcaaaccattcttgatgaa
gtgcgcagtgcgaaacttgcgggtatgtgccctgtgcagaccgaccaacatgttctgaat
gtcgtgtcacaccagctgcattga
              
                            

Download fasta file
RegulonDB