RegulonDB RegulonDB 10.10: Gene Sequence
tcyJ gene sequence


Size: 801        A: 220  T: 182  G: 237  C: 162

Fasta

 

>tcyJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaattagcacatctgggacgtcaggcattgatgggtgtgatggccgtggcgctggtt
gcgggcatgagcgttaaaagttttgcagatgaaggtctgcttaataaagttaaagagcgc
ggcacgctgctggtagggctggaaggaacttatccgccgttcagttttcagggagatgac
ggcaaattaaccggttttgaagtggaatttgcccaacagctggcaaaacatcttggcgtt
gaggcgtcactaaaaccgaccaaatgggacggtatgctggcgtcgctggactctaaacgt
attgatgtggtgattaatcaggtcaccatttctgatgagcgcaagaaaaaatacgatttc
tcaaccccgtacaccatttctggtattcaggcgctggtgaaaaaaggtaacgaaggcacc
attaaaacagccgatgatctgaaaggcaaaaaagtgggggtcggtctgggcaccaactat
gaagagtggctgcggcagaatgttcagggcgtcgatgtgcgtacctatgatgatgacccg
accaaatatcaggatctgcgcgtagggcgtatcgatgcgatcctcgttgatcgtctggcg
gcgctggatctggtgaagaaaaccaacgatacgctggcagtaaccggtgaagcattctcc
cgtcaggagtctggcgtggcgctgcgtaaaggaaatgaggacctgctgaaagcagtgaat
gatgcaattgcggaaatgcaaaaagatggcactctgcaagccctttccgaaaaatggttt
ggtgctgatgtgaccaaataa
              
                            

Download fasta file
RegulonDB