RegulonDB RegulonDB 10.9: Gene Sequence
dsrB gene sequence


Size: 189        A: 47  T: 45  G: 62  C: 35

Fasta

 

>dsrB E. coli K12. Version NC_000913.3 GI:556503834
atgaaggtgaatgatcgggtaacagtcaaaacggatggcggtccgcgtcgtcctggcgtg
gtactggcagttgaggagtttagtgaaggcacaatgtacctggtttcgctggaagactac
ccgctcggcatctggttctttaatgaagcagggcatcaggacggtatctttgtggagaaa
gcagagtaa
              
                            

Download fasta file
RegulonDB