RegulonDB RegulonDB 10.9: Gene Sequence
yodD gene sequence


Size: 228        A: 67  T: 50  G: 62  C: 49

Fasta

 

>yodD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaccgcaaaagagtacagcgataccgcaaaacgtgaggtcagcgtcgatgtcgat
gccctgctggcggcgatcaatgaaattagcgaaagcgaagttcatcgcagccagaacgat
tctgaacacgttagcgtcgatggacgtgaatatcatacatggcgtgaattggcggatgcc
ttcgaactggatattcatgacttcagcgtctctgaagtgaatcgttga
              
                            

Download fasta file
RegulonDB