RegulonDB RegulonDB 10.8: Gene Sequence
msrQ gene sequence


Size: 636        A: 142  T: 189  G: 155  C: 150

Fasta

 

>msrQ E. coli K12. Version NC_000913.3 GI:556503834
atgcgtctgacagcaaaacaggtgacatggctgaaagtttgcctgcatcttgccggattg
ttgccgtttctctggctggtctgggcgatcaatcacggtggactgggtgccgatccggtg
aaagatattcagcattttactggtcgcactgcactgaaatttttgctggcgaccttgtta
atcacccctctggcacgctacgcaaaacagccgttattgatacgcactcgccgcctgtta
ggattatggtgctttgcctgggcgacactgcatttaacaagttacgcattgctggagctg
ggcgtgaataatctggcgttattaggtaaggagttaattacccggccttatttaacgtta
ggtattatcagctgggtaattttgcttgctttagcgttcacttcaacccaggcgatgcag
cgaaaactcggcaagcactggcaacagttgcataatttcgtctatcttgtcgcgattctg
gccccaatacattatctgtggtccgtgaagattatttcaccgcagccgctcatctacgct
gggctggctgtactgcttttagccttacggtataagaagttgcgttccctttttaaccgg
ttacgcaagcaggttcacaacaaattatctgtataa
              
                            

Download fasta file
RegulonDB