RegulonDB RegulonDB 10.8: Gene Sequence
yeeY gene sequence


Size: 930        A: 229  T: 232  G: 254  C: 215

Fasta

 

>yeeY E. coli K12. Version NC_000913.3 GI:556503834
atgaaaccactgctggatgtgttgatgatcctcgatgccttagaaaaagaaggcagtttt
gcggcggcgtcggccaaactctacaagacgccgtccgctctgagttacaccgttcacaag
ctggaaagcgaccttaatattcaattgcttgatcgtagcggacaccgcgctaaattcacc
cgcaccggaaaaatgttattagagaaagggcgggaagttctgcataccgtgcgggaactg
gaaaagcaggcgatcaaactgcatgaaggctgggaaaacgagctggtgattggcgtggac
gacacgtttcctttttctctgcttgcgccactcattgaagctttttatcaacatcatagc
gtgacgcgcctgaagtttatcaatggcgtactcggtggttcatgggatgccctgactcag
gggcgagcggatattattgttggcgcgatgcatgagccaccatcttccagtgagtttggt
ttttcacggttgggcgatctggaacaagtctttgcggtcgcgcctcatcatccgttagcc
ctggaagaagagccgttaaatcgtcgtattattaagcgatatcgggcgattgtggtgggg
gatactgcgcaggcaggcgcttctacggcatcacaacttctcgacgaacaagaagccatt
accgttttcgattttaaaaccaaactggagctgcaaattagcggcctcggctgcggctat
ttaccccgttatctggcgcaacgttttctcgatagtggcgcgttaatcgagaagaaagtg
gtcgcccaaactctctttgaacccgtctggattggctggaacgaacagaccgcaggactt
gccagtggctggtggcgggatgaaattttagcaaatagtgcgatcgccggtgtttatgca
aaatctgatgacggaaaatcagccatttaa
              
                            

Download fasta file
RegulonDB