RegulonDB RegulonDB 10.10: Gene Sequence
mdtA gene sequence


Size: 1248        A: 325  T: 233  G: 354  C: 336

Fasta

 

>mdtA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaggtagttataaatcccgttgggtaatcgtaatcgtggtggttatcgccgccatc
gccgcattctggttctggcaaggccgcaatgactcccggagtgcagccccaggggcgacg
aaacaagcgcagcaatcgccagcgggtggtcgacgtggtatgcgttccggcccattagcc
ccggttcaggcggcgaccgccgtagaacaggcagttccgcgttacctcaccgggcttggc
accattaccgccgctaataccgttacggtgcgcagccgcgtggacggccaactgatagcg
ttacatttccaggaaggccagcaggtcaaagcaggcgatttactggcagaaattgacccc
agccagttcaaagttgcattagcacaagcccagggccaactggcaaaagataaagccacg
cttgccaacgcccgccgtgacctggcgcgttatcaacaactggcaaaaaccaatctcgtt
tcccgccaggagctggatgcccaacaggcgctggtcagtgaaaccgaaggcaccattaag
gctgatgaagcaagcgttgccagcgcgcagctgcaactcgactggagccggattaccgca
ccagtcgatggtcgcgttggtctcaagcaggttgatgttggtaaccaaatctccagtggt
gataccaccgggatcgtggtgatcacccagacgcatcctatcgatttagtctttaccctg
ccggaaagcgatatcgctaccgtagtgcaggcgcagaaagccggaaaaccgctggtggta
gaagcctgggatcgcaccaactcgaagaaattaagtgaaggcacgctgttaagtctagat
aaccaaatcgatgccactaccggtacgattaaagtgaaagcacgctttaataatcaggat
gatgcgctgtttcccaatcagtttgttaacgcgcgcatgttagtcgacaccgaacaaaac
gccgtagtgatcccaacagccgccctgcaaatgggcaatgaaggccattttgtctgggtg
ctgaatagcgaaaacaaggtcagcaaacatctggtgacgccgggcattcaggacagtcag
aaagtggtgatccgtgcaggtatttctgcgggcgatcgcgtggtgacagacggcattgat
cgcctgaccgaaggggcgaaagtggaagtggtggaagcccagagcgccactactccggaa
gagaaagccaccagccgcgaatacgcgaaaaaaggagcacgctcctga
              
                            

Download fasta file
RegulonDB