RegulonDB RegulonDB 10.9: Gene Sequence
lpxT gene sequence


Size: 714        A: 168  T: 231  G: 162  C: 153

Fasta

 

>lpxT E. coli K12. Version NC_000913.3 GI:556503834
atgattaaaaatttgccgcaaatagtgttgttgaatattgtcggcctcgcgctgtttctt
tcctggtatatccccgttaatcatggattctggttgccgattgatgcggatattttttat
ttctttaatcagaaactggtcgaaagtaaggcctttttgtggctggttgcattgaccaac
aatcgcgccttcgacggttgttcactgctggcgatgggtatgttgatgctgagtttctgg
ctgaaagaaaacgcccctggcagacgacgtatcgtgattattggtctggtcatgctatta
actgcagtggtattaaaccagctgggtcaggcattaattcctgtaaaacgggccagccca
acattgacttttaccgatattaaccgcgtcagcgaactgctctctgttcccacgaaagat
gcctcacgagatagctttcccggcgatcacggcatgatgctgcttattttttcggcattc
atgtggcgttatttcggcaaagttgcaggccttatcgcccttattatttttgtggttttt
gcatttcccagagtaatgattggcgcacactggtttactgacatcattgtcggttcgatg
accgtgatattgatcggtttgccctgggtgttgctgacgccattaagtgatcgattaatc
accttttttgacaaatcactaccaggaaaaaacaaacatttccaaaacaaataa
              
                            

Download fasta file
RegulonDB