RegulonDB RegulonDB 10.8: Gene Sequence
yfaQ gene sequence


Size: 1650        A: 381  T: 368  G: 480  C: 421

Fasta

 

>yfaQ E. coli K12. Version NC_000913.3 GI:556503834
gtgaactggcgcagaatcgtctggctattggcgttggttactctgccaacacttgcggag
gagacgccgttacaactggtgctgcgcggtgcgcagcacgatcaactgtatcagctgtcg
tcatcaggcgtgaccaaagtctcagcattacctgactcgctcaccacgccgttagggagt
ttgtggaaactgtatgtttacgcctggctggaggatacccatcaaccggagcagccctac
cagtgtcgcggaaactccccggaagaggtttattgttgtcaggctggggagagcataacg
cgcgataccgcgctggtacgttcctgtgggctctattttgcgccgcagcggttgcatatt
ggcgcagatgtgtgggggcaatactggcaacagcgtcaggcacctgcgtggttagcgtct
ctgactacgctgaagccagaaacctcggtaacggttaaatcgctgcttgattcattagcg
acgttacccgcgcaaaacaaagctcaggaagtcttactggatgtggtgctggacgaggcg
aaaatcggtgtcgcatccatgctcggtagtcgggtacgggtgaaaacctggagctggttt
gccgatgataaacaggaaatccgtcagggtggttttgctggctggttaaccgatggtaca
ccgctgtgggttactggcagtggcaccagcaaaacggtactaacccgttatgcgacggtg
cttaatcgggttttgccagtgccgacgcaggttgccagtgggcaatgtgtagaggtggag
ctgtttgcccgctatccgctgaagaaaatcacagcggaaaagagtacgacggcagtaaat
cccggcgtacttaatgggcgctatcgtgtgacgtttactaatggtaaccacattacgttt
gtcagccacggtgagacgaccttactgagcgaaaagggcaaactgaaattgcagtcgcat
ctcgatcgtgaagagtacgttgccagagttctggatcgcgaggcgaaaagtacgccccct
gaggcagcgaaagccatgaccgtggcgattcgcacttttttacagcaaaacgccaatcgg
gaaggcgattgcctgaccatccccgacagcagcgccacgcagcgtgtttctgcttcgcca
gcgaccacgggggcgcgaacgatgaccgcctggacgcaggatctcatctatgcaggcgat
ccggttcattatcatggcagtcgcgctaccgaagggacactttcctggcggcaagccacg
gcccaggcggggcagggagagcgttacgatcagatactcgcgtttgcttatcccgacaac
agtcttagccgctggggagcgccacgctcaacctgccagttattacccaaagcgaaagcc
tggctggcgaaaaaaatgccgcagtggcggcgtatattacaagctgagacggggtacaac
gaaccagacgtgtttgcggtttgccgtttagtctcaggtttcccctataccgatcggcag
cagaaacggctgtttattcgtaacttctttacgcttcaggatcggctggatttaacccat
gagtatctgcacctggcctttgatggttatcccaccgggcttgatgagaactatatcgaa
acgctgacccgacaattattaatggactaa
              
                            

Download fasta file
RegulonDB