RegulonDB RegulonDB 10.8: Gene Sequence
yfaZ gene sequence


Size: 543        A: 124  T: 130  G: 171  C: 118

Fasta

 

>yfaZ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaattgcgctagcaggtctggccggaatgctgttggtttctgcatcggtcaat
gcaatgagcatcagcggtcaggcgggtaaagaatacaccaatattggtgtcggttttggg
actgaaacgacgggcctggcgttaagcggtaactggacacataacgacgacgacggtgat
gtcgctggcgtggggctggggttgaatctgcctctcgggccgttaatggcgaccgttggc
ggaaaaggcgtttacaccaacccgaattacggcgatgaaggttatgccgcagcggtagga
ggtggtttgcagtggaaaattggcaacagcttccgtttgtttggcgagtattactactct
ccggattcgctctccagcggtattcaaagttatgaagaagcgaatgctggcgcgcgttac
accattatgcgtccagtcagtattgaggcgggttatcgctacctgaatctgtcgggtaaa
gacggtaaccgcgacaacgccgtggctgacggcccgtatgttggggttaacgccagtttc
tga
              
                            

Download fasta file
RegulonDB