RegulonDB RegulonDB 10.8: Gene Sequence
nudI gene sequence


Size: 426        A: 115  T: 108  G: 117  C: 86

Fasta

 

>nudI E. coli K12. Version NC_000913.3 GI:556503834
gtgcgacaacggactattgtatgccctttgattcaaaatgatggtgcttatttgctgtgt
aaaatggccgacgatcgcggcgttttccccggtcaatgggcgatttcgggtggcggcgtg
gagcctggcgaacgaattgaagaggcactacgccgcgaaattcgcgaagaactgggagaa
cagctgcttttgacagaaatcacgccgtggaccttcagcgatgatattcgcaccaagacg
tatgcagatggtcgcaaggaagagatttatatgatttacctgatttttgactgcgtttct
gccaaccgagaagtgaaaataaacgaagagtttcaggactacgcgtgggtaaaacctgaa
gatctggtgcattatgatttgaatgtcgccacccgaaaaacgttacgtttgaaaggtctt
ctgtaa
              
                            

Download fasta file
RegulonDB