RegulonDB RegulonDB 10.8: Gene Sequence
ais gene sequence


Size: 603        A: 168  T: 174  G: 134  C: 127

Fasta

 

>ais E. coli K12. Version NC_000913.3 GI:556503834
gtgttagctttttgccgctcttcgttgaagtcaaaaaaatatatcatcattttactggcg
ctcgctgcaattgccggactgggtactcatgccgcctggagtagcaatggtttgccacgt
atcgacaataaaacactggccagactggcacagcagcacccggttgtcgttttgtttcgt
catgctgaacgttgcgaccgttcaaccaatcaatgcttgtcagataaaacaggtattacg
gttaaaggtacccaggatgcccgtgaactgggcaacgcttttagtgctgatatccctgat
ttcgatctttattccagtaataccgtccggaccattcagtcggctacctggttttcagcg
ggtaaaaaattgacggtagataaacgacttcttcagtgcggtaatgagatttatagtgca
attaaggacttacaaagcaaagcgcctgataaaaatatcgttattttcacccataatcat
tgcctgacatatattgctaaagataagcgtgacgcgacatttaaacctgattatctggat
ggtttagtcatgcatgtggaaaaaggcaaagtttatctggatggggaattcgttaaccac
taa
              
                            

Download fasta file
RegulonDB