RegulonDB RegulonDB 10.8: Gene Sequence
arnB gene sequence


Size: 1158        A: 288  T: 276  G: 288  C: 306

Fasta

 

>arnB E. coli K12. Version NC_000913.3 GI:556503834
atggcggaaggaaaagcaatgtcagaatttttgcctttttcgcgaccagcaatgggcgtg
gaggaactcgctgcagttaaagaggttctcgaatccggttggatcacaaccggtccgaag
aatcaggcgcttgagcaagctttttgccagttgacgggaaatcagcatgccatcgcggtc
agttcagccaccgccggaatgcatatcacgctaatggcgttgaaaattggcaagggcgat
gaagtgattacgccttccctgacctgggtttcaaccctcaatatgatttccttgttgggt
gcaacgccggtaatggtggatgtcgaccgcgatacgctgatggtcacgcctgaagctatc
gagtcagccattacgccacgcactaaagccatcattccggtgcattatgccggtgcgcca
gcagatattgacgccattcgcgccattggcgaacgttacggcatcgcagttatcgaagat
gctgcccatgccgtcggtacgtattacaaagggcgacatattggcgcaaaaggtaccgct
attttttcatttcatgccattaaaaatattacctgtgctgaaggtggcctgattgtaact
gataatgaaaaccttgcccgccagctacggatgctgaaatttcacggtctgggtgtcgat
gcctatgacagacaaacctggggccgtgcaccgcaggctgaagtcttaacaccgggctat
aagtacaatctgaccgatattaacgccgcgattgccctgacacagttagtcaaattagag
cacctcaacacccgtcggcgcgaaattgcccagcaatatcagcaagcactggcagctctc
ccctttcagccattaagccttcccgcctggccgcacgttcacgcctggcatctgtttatt
attcgtgtcgatgaacaacgttgtggtatcagtcgcgatgcgttgatggaagcgttaaaa
gaaagaggcattggtaccgggttacatttccgcgccgctcacacacaaaaatattatcgc
gagcgttttcccacgctgtcgttaccgaataccgaatggaatagcgaacgcatctgttct
ttgccgctgttcccggatatgactaccgccgatgccgaccatgtcatcacagcccttcag
caactcgcaggacaataa
              
                            

Download fasta file
RegulonDB