RegulonDB RegulonDB 10.8: Gene Sequence
arnT gene sequence


Size: 1653        A: 348  T: 462  G: 438  C: 405

Fasta

 

>arnT E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcggtacgttaccttatcggcctcttcgcgtttattgcctgctattacctgtta
ccgatcagcacgcgtctgctctggcaacccgatgaaacgcgttatgcggaaatcagtcga
gaaatgctggcatccggcgactggattgtgccccatctgttagggctacgttatttcgaa
aaacccattgccggatactggattaacagcattgggcaatggctatttggcgcgaataac
tttggtgtgcgggcaggcgttatctttgcgaccctgttaactgccgcgctggtgacctgg
tttactctgcgcttatggcgcgataaacgtctggctctactcgccacagtaatttatctc
tcattgtttattgtctatgccatcggcacttatgccgtgctcgatccgtttattgcattc
tggctggtggcgggaatgtgcagcttctggctggcaatgcaggcacagacgtggaaaggc
aaaagcgcaggatttttactgctgggaatcacctgcggcatgggggtgatgaccaaaggt
tttctcgcccttgccgtgccggtattaagcgtgctgccatgggtagcgacgcaaaaacgc
tggaaagatctctttatttacggctggctggcggttatcagttgcgtactgacggttctc
ccttggggactggcgatagcgcagcgggagcctaacttctggcactattttttctgggtt
gagcatattcaacgctttgcactggatgatgcccaacatagagctccgttctggtactac
gtgccggtcatcattgccggtagcctgccgtggctgggattactccccggtgcactgtac
acaggctggaaaaaccgcaagcattccgcaaccgtctatttgttgagctggacgataatg
ccgctgctgtttttctccgtcgctaaaggtaaattgcccacctatattctttcctgcttt
gcatctctggcaatgctgatggcgcattacgctttgctggcagcaaaaaataatcctctg
gcgctgcggattaatggctggattaacatcgcttttggcgtcactggcattattgccaca
tttgtggtctccccgtggggaccaatgaacacgccggtgtggcaaaccttcgagagctat
aaagtcttttgtgcctggtcgattttttcgctatgggcatttttcggctggtacacctta
acaaacgtcgaaaagacctggccttttgccgcgctttgcccgctggggctggcgttgctg
gtaggattttcaattcctgacagagttatggaaggaaaacatccgcaattttttgtcgag
atgacacaagaatcacttcagccaagccgctatattcttactgatagcgtcggtgttgcc
gcaggtctggcatggagcctgcaacgcgatgacatcatcatgtatcgccagacaggtgag
ttgaaatacggccttaattatccggatgcgaaagggagatttgtcagcggtgatgagttc
gcaaactggcttaatcaacatcgtcaggaggggattattactctcgtgctttcggttgac
cgcgatgaagatatcaacagtctcgccattccgcccgcagatgccatcgatcgtcaggag
cgtctggtgctgattcagtatcgtcccaaatga
              
                            

Download fasta file
RegulonDB