RegulonDB RegulonDB 10.9: Gene Sequence
yfcJ gene sequence


Size: 1179        A: 183  T: 329  G: 369  C: 298

Fasta

 

>yfcJ E. coli K12. Version NC_000913.3 GI:556503834
atgactgctgtaagccaaaccgaaacacgatcttctgccaatttttcgctcttccgcatc
gcttttgcggtttttctcacctacatgaccgtagggttgccgttgccggttatcccgctg
tttgttcatcatgaactgggctatggcaataccatggtcggcattgccgtcgggattcag
tttctggctacggtgctgacgcgtggttacgccgggcgactggccgatcaatatggtgca
aaacgttcggcgcttcagggaatgttagcttgtggtctggctggcggcgcgttgctgctg
gcggcgattttgcctgtctccgcaccgttcaaatttgctctgttggtcgtcgggcgtttg
attcttggctttggtgaaagccagttactgacaggcgctctgacctggggactaggcatc
gtagggccaaaacactctggcaaagtgatgtcatggaacggaatggcgatttacggtgcc
ctcgctgttggtgctccgcttggcctgttgattcatagccattacggttttgccgcactg
gcgatcaccacaatggtattacccgtactggcgtgggcctgtaacggcacagtgcgcaaa
gtaccggccctggcgggagaacgtccatcgctgtggagcgttgtcgggcttatctggaaa
ccagggttaggtctggcactacaaggcgttggttttgctgttatcgggactttcgtttcg
ctctactttgccagcaaaggatgggcgatggcgggctttactcttaccgcgtttggcggc
gcatttgtcgtgatgcgcgtcatgtttggctggatgccggaccgttttggcggcgtgaaa
gtggcgattgtctctctgcttgtagaaacggtgggcttgttgctgctctggcaagcccca
ggtgcatgggtcgcattagcgggcgcggcgttaaccggagccggatgttcgcttatcttt
cctgcgctgggcgtggaggtggttaaacgcgtcccctcacaagttcgcggcaccgcactg
ggcggttacgccgcgtttcaggatatcgccctcggcgtctccgggccgctggcgggaatg
ctggcgaccacgtttggttactcttcggtatttcttgccggggcgatctctgcggtgctg
ggtattattgtcacgatactgtcatttcgtcggggttaa
              
                            

Download fasta file
RegulonDB