RegulonDB RegulonDB 10.8: Gene Sequence
smrB gene sequence


Size: 552        A: 134  T: 124  G: 167  C: 127

Fasta

 

>smrB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagaaaacaacacttagcgaggaggaccaggctctgtttcgccagttgatggcg
gggactcgcaagattaagcaggacacgattgtccaccgaccgcagcgtaaaaaaatcagc
gaagtgccggtgaaacgcttgatccaggagcaggctgatgccagccattatttctccgat
gagtttcagccgttattaaataccgaaggtccggtgaaatatgttcgcccggatgtcagc
cattttgaggcgaagaaactgcgccgtggcgattattcgccggagttgtttttggattta
cacggtctgacgcagctgcaggccaagcaggaactgggggcgttgattgccgcctgccgc
cgtgaacatgtgttttgcgcctgcgtgatgcatgggcacgggaagcatattttgaagcaa
caaacaccgctgtggctggcacaacatccgcatgtgatggcctttcatcaggcaccaaaa
gagtatggcggtgatgcggcgttgttggtgttgattgaagtcgaagagtggctgccgccg
gagttgccctga
              
                            

Download fasta file
RegulonDB