RegulonDB RegulonDB 10.8: Gene Sequence
yfcO gene sequence


Size: 822        A: 213  T: 235  G: 209  C: 165

Fasta

 

>yfcO E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatactacgatggttgttcgctctggtcatgcttattgctactacagaagctatg
gctgccgggcatagcgttgacgtttactacggttacaacggtgattcgcgtaatattgcg
acttttaatttaaaaataatgatgccatccgcagtgtacgttggtgaatataaaagtagt
caatggctcatgactggggaaatattgcaaaatgtgagctggagtggtcctcctcctgcc
ccttcggttaagctgattggctaccatcaaaatatcaacaaagcaagttgtcctggatta
ccgtctgggtggaactgcgggtattatacatttgaggttattgtctctgcagagattgaa
tcttacttttcttgtccatggttggttattatgaatgactctgaagcctctccagggggc
gtgacgtatcaggggcctgatagtcacgacacgatttgtccatccgtttctgttcaacct
tatgacgtttcatggaatgagaattatgtcagtaagtcaaaactgctcaccctgcagtcg
acgggcggtgtggttgagaaaacgctttcaacgtatttgatgaaagatgggaagttgtgc
gacagtacgcagatgaatgaaacaggtggttactgccgctgggttgcacagatgataact
tttaccgcgtcgggatgtgacaaggcggaagtctcggtcacgccaaatcgacaccctata
acggacaaacagttacacgatatggtcgtgcgtgttgataccagcagtatgcagccaatc
gattctacttgccggttccagtacatactgaatgagttgtag
              
                            

Download fasta file
RegulonDB