RegulonDB RegulonDB 10.8: Gene Sequence
yfcP gene sequence


Size: 540        A: 145  T: 132  G: 147  C: 116

Fasta

 

>yfcP E. coli K12. Version NC_000913.3 GI:556503834
atgaataaatcaatgattcagtccggtggttacgtcctgttagcggggctgatattggca
atgagtagcacgttattcgcggcagataataatctgcatttctccggtaatttattaagt
aaatcctgtgcgctggtggtggatggccaatatctggcagaggtgcgctttcccacggtc
agtcgtcaggatttgaacgttgcaggccagtccgctcgtgtacccgtagtctttaagctg
aaagattgcaaagggccggcgggatacaacgtaaaagtcacgctcacgggggtagaagac
agcgaacaacccggttttctggcactggatacgtcatcaaccgctcagggagtgggaatt
ggcatggaaaaaaccgacggaatgcaggttgccatcaacaatacaaatggggcgaccttt
gcgctaaccaatggcaataacgatatcaatttcagagcctggctacaggcgaaaagcggc
cgtgatgtgacgatcggtgaatttaccgcctctttaactgcgacatttgagtatatttaa
              
                            

Download fasta file
RegulonDB