RegulonDB RegulonDB 10.8: Gene Sequence
yfcQ gene sequence


Size: 489        A: 134  T: 127  G: 112  C: 116

Fasta

 

>yfcQ E. coli K12. Version NC_000913.3 GI:556503834
atgagaaagactttcttaaccctgctttgtgtcagtagcgccatagctcatgctgctgat
gaagacatcacctttcacgggacattattgtcaccgccaacctgtagcatcagcggtggt
aaaaccattgaagtcgaatttcgcgatctcattatcgacgacatcaacggcaactatggt
cgtaaagaggtgccatatgaactcacttgtgactcgacgacccgtcatccagattgggag
atgaccctcacctggactggtacacaaaccagttttaatgatgcagcaattgaaactgat
gtacccggttttggtatcgagcttcagcacgatggtcagcgttttaaactcaatactccg
cttgctatcaacgccactgattttacgcaaaagccgaagctggaggccgtaccggtaaaa
gcgagtgatgctgtgttaagcgatacgaatttttcggcttacgcaacattacgggtggat
tatcaatga
              
                            

Download fasta file
RegulonDB